Home Downloads UCSC Genome Browser Track Email Updates

Varaico: Literature-Extracted Genetic Variants

Include likely false extractions

Gene:BRCA2

Variant:p.R2418_R2424Fs

Back to variants list

BRCA2

NM_000059.4:p.R2418_R2424Fs

hg38:chr13:32355105 AGAGTTGAACAGTGTGTTAG>T

Associated Papers

RNA-based analysis of BRCA1 and BRCA2 gene alterations.

Bonatti F et al.

Cancer Genetics and Cytogenetics, 2006

17011978 (PubMed )

Select a paper to view details

UCSC Genome Browser·Imprint·Privacy·Terms·Feedback·Email Updates·

Regarding the variants extracted from papers and shown text snippets from research papers, the following holds: "Some rights reserved. This work permits non-commercial use, distribution and reproduction in any medium, provided the original author and source are credited."