Home Downloads UCSC Genome Browser Track Email Updates

Varaico: Literature-Extracted Genetic Variants

Include likely false extractions

Gene:CXXC1

Variant:p.S264_P270delFs

Back to variants list

CXXC1

NM_014593.4:p.S264_P270delFs

hg38:chr18:50285105 GGAGGCTCCTTGACTGTTGA>G

Associated Papers

Molecular Signatures of Response to Mecasermin in Children With Rett Syndrome.

Shovlin S et al.

Frontiers in Neuroscience, 2022

35712450 (PubMed )

Select a paper to view details

UCSC Genome Browser·Imprint·Privacy·Terms·Feedback·Email Updates·

Regarding the variants extracted from papers and shown text snippets from research papers, the following holds: "Some rights reserved. This work permits non-commercial use, distribution and reproduction in any medium, provided the original author and source are credited."