Home Downloads UCSC Genome Browser Track Email Updates

Varaico: Literature-Extracted Genetic Variants

Include likely false extractions

Gene:DAND5

Variant:p.M1Fs

Back to variants list

DAND5

NM_152654.3:p.M1Fs

hg38:chr19:12969662 T>TCATTTGGGCTCCTCATTTG

Associated Papers

PRPH2-Related Retinal Diseases: Broadening the Clinical Spectrum and Describing a New Mutation.

Coco-Martin RM et al.

Genes, 2020

32660024 (PubMed )

Select a paper to view details

UCSC Genome Browser·Imprint·Privacy·Terms·Feedback·Email Updates·

Regarding the variants extracted from papers and shown text snippets from research papers, the following holds: "Some rights reserved. This work permits non-commercial use, distribution and reproduction in any medium, provided the original author and source are credited."