Home Downloads UCSC Genome Browser Track Email Updates

Varaico: Literature-Extracted Genetic Variants

Include likely false extractions

Gene:DPEP2NB

Variant:p.E94_S95insFs

Back to variants list

DPEP2NB

NM_001282442.2:p.E94_S95insFs

hg38:chr16:68014198 C>CCTCTATCGTAGCTTGACGT

Associated Papers

Characterization of the genomic alterations in poorly differentiated thyroid cancer.

Lee Y et al.

Scientific Reports, 2023

37932340 (PubMed )

Supplement: 41598_2023_46466_MOESM2_ESM.xlsx › P12

Select a paper to view details

UCSC Genome Browser·Imprint·Privacy·Terms·Feedback·Email Updates·

Regarding the variants extracted from papers and shown text snippets from research papers, the following holds: "Some rights reserved. This work permits non-commercial use, distribution and reproduction in any medium, provided the original author and source are credited."