Home Downloads UCSC Genome Browser Track Email Updates

Varaico: Literature-Extracted Genetic Variants

Include likely false extractions

Gene:ESRP2

Variant:p.F222_I228delFs

Back to variants list

ESRP2

NM_024939.3:p.F222_I228delFs

hg38:chr16:68232787 TATCACCTCGGGCTTCGAAA>T

Associated Papers

ESRP1 Mutations Cause Hearing Loss due to Defects in Alternative Splicing that Disrupt Cochlear Development.

Rohacek AM et al.

Developmental Cell, 2017

29107558 (PubMed )

Select a paper to view details

UCSC Genome Browser·Imprint·Privacy·Terms·Feedback·Email Updates·

Regarding the variants extracted from papers and shown text snippets from research papers, the following holds: "Some rights reserved. This work permits non-commercial use, distribution and reproduction in any medium, provided the original author and source are credited."