Associated Papers
Spectrum of Beta-Thalassemia Mutations in Potential Carriers with Microcytic Hypochromic Anemia from Mazandaran and Golestan, Northern Provinces of Iran.
Mousavi SS et al.
Biomed Research International, 2024
Evaluation of in silico predictors on short nucleotide variants in HBA1, HBA2, and HBB associated with haemoglobinopathies.
Tamana S et al.
Elife, 2022
36453528 (PubMed )
Supplement: elife-79713-supp2.xlsx › Input-HBB
Background splicing as a predictor of aberrant splicing in genetic disease.
Alexieva D et al.
Rna Biology, 2022
35188075 (PubMed )
Supplement: KRNB_A_2024031_SM7960.zip › Supplementary_information › Table_S2_css.xlsx › Table_S2_DBASS5_index
Molecular and Hematological Analysis of Alpha- and Beta-Thalassemia in a Cohort of Mexican Patients.
Rizo-de la Torre LDC et al.
Genetic Testing and Molecular Biomarkers, 2021
Analysis of a Novel Mexican Variant of the HBB Gene Associated with β-Thalassemia Using Bioinformatic Tools.
Martínez Villegas O et al.
Hemoglobin, 2021
Three Mexican Families with β thalassemia intermedia with different molecular basis.
Torre LDCR et al.
Genetics and Molecular Biology, 2020
The Scope for Thalassemia Gene Therapy by Disruption of Aberrant Regulatory Elements.
Patsali P et al.
Journal of Clinical Medicine, 2019
31766235 (PubMed )
Supplement: jcm-08-01959-s001.pdf
Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.
Rizo-de-la-Torre LC et al.
International Journal of Laboratory Hematology, 2017
Select a paper to view details