Associated Papers
Molecular and Hematological Analysis of Alpha- and Beta-Thalassemia in a Cohort of Mexican Patients.
Rizo-de la Torre LDC et al.
Genetic Testing and Molecular Biomarkers, 2021
Analysis of a Novel Mexican Variant of the HBB Gene Associated with β-Thalassemia Using Bioinformatic Tools.
Martínez Villegas O et al.
Hemoglobin, 2021
Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.
Rizo-de-la-Torre LC et al.
International Journal of Laboratory Hematology, 2017
The Spectrum of β-Thalassemia Mutations in a Population from the Brazilian Amazon.
Silva AN et al.
Hemoglobin, 2016
Select a paper to view details