Associated Papers
Comprehensive analysis of sickle β+-thalassemia genotypes and their associated HbA levels in France.
Baltus C et al.
Blood Cells, Molecules & Diseases, 2025
Non-Invasive Determination of the Paternal Inheritance in Pregnancies at Risk for β-Thalassaemia by Analyzing Cell-Free Fetal DNA Using Targeted Next-Generation Sequencing.
Byrou S et al.
International Journal of Molecular Sciences, 2025
Identification of a β-Globin Gene Mutation with the Genotype β-28(A > G), IVS-I-5(G > A)/βCD 71/72(+A) Using Third-Generation Sequencing.
Zeng GK et al.
Hemoglobin, 2025
Genetic analysis of TMPRSS6 catalytic domain variants in Mexican patients with iron treatment refractoriness.
Hernández-Peña R et al.
Laboratory Medicine, 2024
Genetic epidemiology of thalassemia in couples of childbearing age: over 6 years of a thalassemia intervention project.
Zheng X et al.
Molecular Biology Reports, 2024
Severe clinical picture in a cohort of six Brazilian children with hemoglobin Sβ-thalassemia IVS-I-5 G>A.
Viana MB et al.
Blood Cells, Molecules & Diseases, 2024
Clinical significance of mutational variants in beta and alpha genes in patients with hemoglobinopathies from two large Greek centers: a complex interplay between genotype and phenotype.
Diamantidis MD et al.
Journal of Molecular Medicine (berlin, Germany), 2023
The beta thalassaemia trait in Jamaica.
Serjeant GR et al.
Journal of Community Genetics, 2023
A Novel Tool for the Analysis and Detection of Copy Number Variants Associated with Haemoglobinopathies.
Minaidou A et al.
International Journal of Molecular Sciences, 2022
Evaluation of in silico predictors on short nucleotide variants in HBA1, HBA2, and HBB associated with haemoglobinopathies.
Tamana S et al.
Elife, 2022
Heterozygosity of the Complex Corfu δ0β+ Thalassemic Allele (HBD Deletion and HBB:c.92+5G>A) Revisited
Kattamis C et al.
Biology, 2022
Background splicing as a predictor of aberrant splicing in genetic disease.
Alexieva D et al.
Rna Biology, 2022
Molecular and Hematological Analysis of Alpha- and Beta-Thalassemia in a Cohort of Mexican Patients.
Rizo-de la Torre LDC et al.
Genetic Testing and Molecular Biomarkers, 2021
An international telemedicine program for diagnosis of genetic disorders: Partnership of pediatrician and geneticist.
Mena R et al.
American Journal of Medical Genetics. Part C, Seminars in Medical Genetics, 2020
Genetic ancestry analysis on >93,000 individuals undergoing expanded carrier screening reveals limitations of ethnicity-based medical guidelines.
Kaseniit KE et al.
Genetics in Medicine : Official Journal of the American College of Medical Genetics, 2020
High-depth African genomes inform human migration and health.
Choudhury A et al.
Nature, 2020
Hb S/β-Thalassemia in the REDS-III Brazil Sickle Cell Disease Cohort: Clinical, Laboratory and Molecular Characteristics.
Belisário AR et al.
Hemoglobin, 2020
Use of an automated pyrosequencing technique for confirmation of sickle cell disease.
de Martino CC et al.
Plos One, 2019
Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.
Rizo-de-la-Torre LC et al.
International Journal of Laboratory Hematology, 2017
Mutational Profile of Homozygous β-Thalassemia in Rio de Janeiro, Brazil.
Carrocini GCS et al.
Hemoglobin, 2017
The genetic basis of asymptomatic codon 8 frame-shift (HBB:c25_26delAA) β(0) -thalassaemia homozygotes.
Jiang Z et al.
British Journal of Haematology, 2016
The Spectrum of β-Thalassemia Mutations in a Population from the Brazilian Amazon.
Silva AN et al.
Hemoglobin, 2016
Distinctive mutation spectrum of the HBB gene in an urban eastern Indian population.
Sahoo SS et al.
Hemoglobin, 2014
Interpretation of mRNA splicing mutations in genetic disease: review of the literature and guidelines for information-theoretical analysis.
Caminsky N et al.
F1000research, 2014
Prenatal and newborn screening for hemoglobinopathies.
Hoppe CC
International Journal of Laboratory Hematology, 2013
A single nucleotide polymorphism in the HBBP1 gene in the human β-globin locus is associated with a mild β-thalassemia disease phenotype.
Giannopoulou E et al.
Hemoglobin, 2012
Control of human beta-globin mRNA stability and its impact on beta-thalassemia phenotype.
Peixeiro I et al.
Haematologica, 2011
Region-specific genetic heterogeneity of HBB mutation distribution in South-Western Greece.
Papachatzopoulou A et al.
Hemoglobin, 2010
Cryptic splicing sites are differentially utilized in vivo.
Haj Khelil A et al.
The Febs Journal, 2008
Real-time PCR for single-cell genotyping in sickle cell and thalassemia syndromes as a rapid, accurate, reliable, and widely applicable protocol for preimplantation genetic diagnosis.
Vrettou C et al.
Human Mutation, 2004
Abnormally spliced beta-globin mRNAs: a single point mutation generates transcripts sensitive and insensitive to nonsense-mediated mRNA decay.
Danckwardt S et al.
Blood, 2002
Clinical and mutational characterization of three patients with multiple sulfatase deficiency: report of a new splicing mutation.
Díaz-Font A et al.
Molecular Genetics and Metabolism, 0
β-Thalassemia Mutations in Jamaica: Geographic Variation in Small Communities.
Serjeant GR et al.
Hemoglobin, 0
Borderline HbA2 levels: Dilemma in diagnosis of beta-thalassemia carriers.
Colaco S et al.
Mutation Research. Reviews in Mutation Research, 0