Associated Papers
Prevention and control of thalassemia in Guangdong Province, Southern China: insights from an 11-year retrospective study.
Qin D et al.
Annals of Medicine, 2025
Impact of transferrin levels on iron accumulation in transfusion-dependent beta-thalassemia: A genotype-specific analysis.
Liang Y et al.
Journal of Medical Biochemistry, 2025
The 1357 bp deletion in β-thalassemia: molecular profiling and hematological characterization in a Guangxi cohort.
Li Y et al.
Molecular Biology Reports, 2025
Non-Invasive Determination of the Paternal Inheritance in Pregnancies at Risk for β-Thalassaemia by Analyzing Cell-Free Fetal DNA Using Targeted Next-Generation Sequencing.
Byrou S et al.
International Journal of Molecular Sciences, 2025
Active spread of β-thalassemia beyond the thalassemia belt: A study on a Russian population.
Shchemeleva E et al.
Clinical Genetics, 2025
Relevance of Next-Generation Sequencing in the Diagnosis of Thalassemia and Hemoglobinopathies: The Experience of Four Italian Diagnostic Hubs.
Selvatici R et al.
Genes, 2024
Burden of Mendelian disorders in a large Middle Eastern biobank.
Aamer W et al.
Genome Medicine, 2024
Detection of 13 Novel Variants and Investigation of Mutation Distribution by Next Generation Sequencing in Hemoglobinopathies: A Single Center Experience.
Ozalp O et al.
Indian Journal of Hematology & Blood Transfusion : an Official Journal of Indian Society of Hematology and Blood Transfusion, 2024
Unravelling the Complexity of the +33 C>G [HBB:c.-18C>G] Variant in Beta Thalassemia.
Stephanou C et al.
Biomedicines, 2024
The beta thalassaemia trait in Jamaica.
Serjeant GR et al.
Journal of Community Genetics, 2023
Rare and New Mutations of B-Globin in Azari Population of Iran, a Considerable Diversity.
Abbasali FH et al.
Balkan Journal of Medical Genetics : Bjmg, 2023
Evaluation of in silico predictors on short nucleotide variants in HBA1, HBA2, and HBB associated with haemoglobinopathies.
Tamana S et al.
Elife, 2022
Phenotypic variation in sickle cell disease: the role of beta globin haplotype, alpha thalassemia, and fetal hemoglobin in HbSS.
Serjeant GR
Expert Review of Hematology, 2022
The Spectrum of β-Thalassemia Mutations in the Population Migration in Lebanon: A 6-Year Retrospective Study.
Farra C et al.
Hemoglobin, 2021
Genetic ancestry analysis on >93,000 individuals undergoing expanded carrier screening reveals limitations of ethnicity-based medical guidelines.
Kaseniit KE et al.
Genetics in Medicine : Official Journal of the American College of Medical Genetics, 2020
Enabling routine β-thalassemia Prevention and Patient Management by scalable, combined Thalassemia and Hemochromatosis Mutation Analysis.
Hashmi G et al.
Bmc Medical Genetics, 2020
Molecular and geographical heterogeneity of hemoglobinopathy mutations in Azerbaijanian populations.
Aliyeva G et al.
Annals of Human Genetics, 2020
[Gene Diagnosis and Phenotypic Analysis of β-Thalassemia Caused from a Rare Synonymous Mutation CD29 (C>T)].
Qin DQ et al.
Zhongguo Shi Yan Xue Ye Xue Za Zhi, 2020
Genotype-phenotype association analysis identifies the role of α globin genes in modulating disease severity of β thalassaemia intermedia in Sri Lanka.
Perera S et al.
Scientific Reports, 2019
Geographical distribution of β-globin gene mutations in Syria.
Murad H et al.
Hematology (amsterdam, Netherlands), 2018
Frequency of α-Globin Gene Triplications and Coinheritance with β-Globin Gene Mutations in the Iranian Population.
Abedini SS et al.
Hemoglobin, 2018
Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.
Rizo-de-la-Torre LC et al.
International Journal of Laboratory Hematology, 2017
Heterozygous β-thalassemia with complete absence of hemoglobin A2 in a Chinese adult.
Yan JM et al.
International Journal of Laboratory Hematology, 2015
Broader spectrum of β-thalassemia mutations in Oman: regional distribution and comparison with neighboring countries.
Hassan SM et al.
Hemoglobin, 2015
Molecular Basis of β-Thalassemia in the Population of the Aegean Region of Turkey: Identification of A Novel Deletion Mutation.
Ozkinay F et al.
Hemoglobin, 2015
Interaction of an α-Globin Gene Triplication with β-Globin Gene Mutations in Iranian Patients with β-Thalassemia Intermedia.
Farashi S et al.
Hemoglobin, 2015
Repository of mutations from Oman: The entry point to a national mutation database.
Rajab A et al.
F1000research, 2015
MutPred Splice: machine learning-based prediction of exonic variants that disrupt splicing.
Mort M et al.
Genome Biology, 2014
Molecular characterization of a β-thalassemia intermedia patient presenting inferior vena cava thrombosis: interaction of the β-globin erythroid Krüppel-like factor binding site mutation with Hb E and α(+)-thalassemia.
Prajantasen T et al.
Hemoglobin, 2014
Prevalence of β-Thalassemia and hemoglobin E in two migrant populations of Manipur, North East India.
Achoubi N et al.
Genetic Testing and Molecular Biomarkers, 2012
Molecular heterogeneity of beta-thalassemia in Algeria: how to face up to a major health problem.
Boudrahem-Addour N et al.
Hemoglobin, 2009
Rapid genotyping of known mutations and polymorphisms in beta-globin gene based on the DHPLC profile patterns of homoduplexes and heteroduplexes.
Li Q et al.
Clinical Biochemistry, 2008
A family with multiple mutations and sequence variations in the alpha- and beta-globin gene clusters.
de Vooght KM et al.
Clinical Chemistry and Laboratory Medicine, 2008
In vitro and in silico analysis reveals an efficient algorithm to predict the splicing consequences of mutations at the 5' splice sites.
Sahashi K et al.
Nucleic Acids Research, 2007
HbVar: A relational database of human hemoglobin variants and thalassemia mutations at the globin gene server.
Hardison RC et al.
Human Mutation, 2002
Molecular characterization of beta-thalassemia in Syria.
Kyriacou K et al.
Hemoglobin, 2000
The molecular heterogeneity of beta-thalassemia in Greece.
Boussiou M et al.
Blood Cells, Molecules & Diseases, 0