Associated Papers
Evaluation of in silico predictors on short nucleotide variants in HBA1, HBA2, and HBB associated with haemoglobinopathies.
Tamana S et al.
Elife, 2022
36453528 (PubMed )
Supplement: elife-79713-supp2.xlsx › Input-HBB
Molecular and Hematological Analysis of Alpha- and Beta-Thalassemia in a Cohort of Mexican Patients.
Rizo-de la Torre LDC et al.
Genetic Testing and Molecular Biomarkers, 2021
Three Mexican Families with β thalassemia intermedia with different molecular basis.
Torre LDCR et al.
Genetics and Molecular Biology, 2020
Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.
Rizo-de-la-Torre LC et al.
International Journal of Laboratory Hematology, 2017
Select a paper to view details