Associated Papers
Germline predisposition in multiple myeloma.
Martins Rodrigues F et al.
Iscience, 2025
39845416 (PubMed )
Supplement: mmc3.xlsx › ST2D.Vars_in_all_genes_MMRF
Evaluation of in silico predictors on short nucleotide variants in HBA1, HBA2, and HBB associated with haemoglobinopathies.
Tamana S et al.
Elife, 2022
36453528 (PubMed )
Supplement: elife-79713-supp2.xlsx › Input-Full_dataset
Effects of SPTA1 Gene Variants on the Hematological Phenotype of Mexican Patients with Hereditary Spherocytosis.
Herrera-Tirado IM et al.
Genetic Testing and Molecular Biomarkers, 2022
Analysis of a Novel Mexican Variant of the HBB Gene Associated with β-Thalassemia Using Bioinformatic Tools.
Martínez Villegas O et al.
Hemoglobin, 2021
Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.
Rizo-de-la-Torre LC et al.
International Journal of Laboratory Hematology, 2017
Hb A1c Determination by Capillary Electrophoresis is an Efficient Method for Detecting β-Thalassemias and Hemoglobin Variants.
Orts JA et al.
Hemoglobin, 2016
Select a paper to view details