Associated Papers
Association of Glutathione S-transferase gene polymorphism with coronary artery disease (CAD) in North Indian population (Jammu and Kashmir): evidence from a case-control study and an updated meta-analysis.
Raina JK et al.
Inhalation Toxicology, 2025
Non-Invasive Determination of the Paternal Inheritance in Pregnancies at Risk for β-Thalassaemia by Analyzing Cell-Free Fetal DNA Using Targeted Next-Generation Sequencing.
Byrou S et al.
International Journal of Molecular Sciences, 2025
Active spread of β-thalassemia beyond the thalassemia belt: A study on a Russian population.
Shchemeleva E et al.
Clinical Genetics, 2025
Prevalence and Molecular Characterization of β-Thalassemia in Kirkuk Province of Northern Iraq.
Abbas RA et al.
Hemoglobin, 2024
Burden of Mendelian disorders in a large Middle Eastern biobank.
Aamer W et al.
Genome Medicine, 2024
Spectrum Of HBB Gene Variants And Major Endocrine Complications In Thalassemia Patients Of Pakistan.
Ghafoor MB et al.
Jpma. the Journal of the Pakistan Medical Association, 2023
Detection of a Rare Mutation in the Initiation Codon of the β-Globin Gene (HBB:C.2T > C; P.Met1Thr).
Shamoon R et al.
Hemoglobin, 2023
Scalable noninvasive amplicon-based precision sequencing (SNAPseq) for genetic diagnosis and screening of β-thalassemia and sickle cell disease using a next-generation sequencing platform.
Gupta P et al.
Frontiers in Molecular Biosciences, 2023
Evaluation of in silico predictors on short nucleotide variants in HBA1, HBA2, and HBB associated with haemoglobinopathies.
Tamana S et al.
Elife, 2022
Diamond-Blackfan anaemia caused by a de novo initiation codon mutation resulting in a shorter isoform of GATA1.
Chen T et al.
Clinical Genetics, 2022
Assessment of iron overload in a cohort of Sri Lankan patients with transfusion dependent beta thalassaemia and its correlation with pathogenic variants in HBB, HFE, SLC40A1, and TFR2 genes.
Dissanayake R et al.
Bmc Pediatrics, 2022
Hb Narges Lab, a Novel Hemoglobin Variant of the β-Globin Gene.
Hamid M et al.
Archives of Iranian Medicine, 2022
Using DNA testing for the precise, definite, and low-cost diagnosis of sickle cell disease and other Haemoglobinopathies: findings from Tanzania.
Christopher H et al.
Bmc Genomics, 2021
Residual risk for additional recessive diseases in consanguineous couples.
AlAbdi L et al.
Genetics in Medicine : Official Journal of the American College of Medical Genetics, 2021
Predictive SNPs for β0-thalassemia/HbE disease severity.
Munkongdee T et al.
Scientific Reports, 2021
β-Thalassemia pathogenic variants in a cohort of children from the East African coast.
Macharia AW et al.
Molecular Genetics & Genomic Medicine, 2020
Cd60 (GTG > GAG)/Hb Cagliari mutation was found in scanning of β-thalassemia alleles from patients of East Kalimantan, Indonesia.
Susanto Z et al.
Molecular Genetics and Metabolism Reports, 2020
Identification of seven novel variants in the β-globin gene in transfusion-dependent and normal patients.
Aldakeel SA et al.
Archives of Medical Science : Ams, 2020
The phenotypic and molecular diversity of hemoglobinopathies in India: A review of 15 years at a referral center.
Nadkarni AH et al.
International Journal of Laboratory Hematology, 2019
A comprehensive review of the prevalence of beta globin gene variations and the co-inheritance of related gene variants in Saudi Arabians with beta-thalassemia.
Alaithan MA et al.
Saudi Medical Journal, 2018
KLF1 gene and borderline hemoglobin A2 in Saudi population.
Borgio JF et al.
Archives of Medical Science : Ams, 2018
Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.
Rizo-de-la-Torre LC et al.
International Journal of Laboratory Hematology, 2017
Haematological and electrophoretic characterisation of β-thalassaemia in Yunnan province of Southwestern China.
Zhang J et al.
Bmj Open, 2017
Mutations in the β-globin gene from a Saudi population: an update.
Borgio JF et al.
International Journal of Laboratory Hematology, 2016
A genetic score for the prediction of beta-thalassemia severity.
Danjou F et al.
Haematologica, 2015
Genetic Modifiers of Sickle Cell Disease: A Genotype-Phenotype Relationship Study in a Cohort of 82 Children on Mayotte Island.
Muszlak M et al.
Hemoglobin, 2015
Genetic heterogeneity of the β-globin gene in various geographic populations of Yunnan in southwestern China.
Zhang J et al.
Plos One, 2015
Mutation analysis of parkin and PINK1 genes in early-onset Parkinson's disease in China.
Zhang BR et al.
Neuroscience Letters, 2010
Novel mutations in ENG and ACVRL1 identified in a series of 200 individuals undergoing clinical genetic testing for hereditary hemorrhagic telangiectasia (HHT): correlation of genotype with phenotype.
Bossler AD et al.
Human Mutation, 2006
Spectrum of CFTR mutations on Réunion Island: impact on neonatal screening.
Bienvenu T et al.
Human Biology, 2005
Tay-Sachs disease-causing mutations and neutral polymorphisms in the Hex A gene.
Myerowitz R
Human Mutation, 1997
Rare β- and δ-Globin Gene Mutations in the Pathare Prabhus: Original Inhabitants of Mumbai, India.
Gorakshakar AC et al.
Hemoglobin, 0
Borderline HbA2 levels: Dilemma in diagnosis of beta-thalassemia carriers.
Colaco S et al.
Mutation Research. Reviews in Mutation Research, 0