Associated Papers
A next-generation sequencing-based universal target panel and algorithm for one-stop detection of copy number alterations and single-nucleotide variations in the HBB gene cluster for rapid diagnosis of β-thalassemia.
Pal D et al.
Molecular Biology Reports, 2025
Evaluation of in silico predictors on short nucleotide variants in HBA1, HBA2, and HBB associated with haemoglobinopathies.
Tamana S et al.
Elife, 2022
36453528 (PubMed )
Supplement: elife-79713-supp2.xlsx › Input-Full_dataset
Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.
Rizo-de-la-Torre LC et al.
International Journal of Laboratory Hematology, 2017
Red blood cells free α-haemoglobin pool: a biomarker to monitor the β-thalassemia intermedia variability. The ALPHAPOOL study.
Vasseur C et al.
British Journal of Haematology, 2017
Hereditary spherocytosis due to band 3 deficiency: 15 novel mutations in SLC4A1.
Van Zwieten R et al.
American Journal of Hematology, 2013
A Swiss (εγδβ)⁰-thalassemia patient with a novel 3-Mb deletion associated with mild mental impairment.
Von Kanel T et al.
American Journal of Hematology, 2013
Rapid identification of HBB gene mutations by high-resolution melting analysis.
Shih HC et al.
Clinical Biochemistry, 2009
Comparison of the mismatch-specific endonuclease method and denaturing high-performance liquid chromatography for the identification of HBB gene mutations.
Hung CC et al.
Bmc Biotechnology, 2008
Mutational analysis of PAX6: 16 novel mutations including 5 missense mutations with a mild aniridia phenotype.
Grønskov K et al.
European Journal of Human Genetics : Ejhg, 1999
Select a paper to view details