Associated Papers
Heterozygosity of the Complex Corfu δ0β+ Thalassemic Allele (HBD Deletion and HBB:c.92+5G>A) Revisited
Kattamis C et al.
Biology, 2022
Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.
Rizo-de-la-Torre LC et al.
International Journal of Laboratory Hematology, 2017
The mechanism by which TATA-box polymorphisms associated with human hereditary diseases influence interactions with the TATA-binding protein.
Drachkova I et al.
Human Mutation, 2014
The genetic heterogeneity of β-globin gene defects in Sicily reflects the historic population migrations of the island.
Giambona A et al.
Blood Cells, Molecules & Diseases, 2011
Molecular spectrum of beta-thalassemia in the Mexican population.
Perea FJ et al.
Blood Cells, Molecules & Diseases, 0
Select a paper to view details