Home Downloads UCSC Genome Browser Track Email Updates

Varaico: Literature-Extracted Genetic Variants

Include likely false extractions

Gene:IL12RB1

Variant:p.E234insFs

Back to variants list

IL12RB1

NM_005535.3:p.E234insFs

hg38:chr19:18075749 C>CGCAATCAGAACCAAACCAA

Associated Papers

Molecular analysis for patients with IL-12 receptor β1 deficiency.

Ramirez-Alejo N et al.

Clinical Genetics, 2014

23952477 (PubMed )

Select a paper to view details

UCSC Genome Browser·Imprint·Privacy·Terms·Feedback·Email Updates·

Regarding the variants extracted from papers and shown text snippets from research papers, the following holds: "Some rights reserved. This work permits non-commercial use, distribution and reproduction in any medium, provided the original author and source are credited."