Home Downloads UCSC Genome Browser Track Email Updates

Varaico: Literature-Extracted Genetic Variants

Include likely false extractions

Gene:PALB2

Variant:p.L939insFs

Back to variants list

PALB2

NM_024675.4:p.L939insFs

hg38:chr16:23624028 A>AGAATTTCCAGCTTCAGGTG

Associated Papers

Genotype-phenotype and outcome associations in patients with Fanconi anemia: the National Cancer Institute cohort.

Altintas B et al.

Haematologica, 2023

35417938 (PubMed )

Supplement: 2021_279981_ALTINTAS_TABLES_SUPPL.xlsx › Table_S2

Select a paper to view details

UCSC Genome Browser·Imprint·Privacy·Terms·Feedback·Email Updates·

Regarding the variants extracted from papers and shown text snippets from research papers, the following holds: "Some rights reserved. This work permits non-commercial use, distribution and reproduction in any medium, provided the original author and source are credited."