Home Downloads UCSC Genome Browser Track Email Updates

Varaico: Literature-Extracted Genetic Variants

Include likely false extractions

Gene:PRPF31

Variant:p.L301_S307delFs

Back to variants list

PRPF31

NM_015629.4:p.L301_S307delFs

hg38:chr19:54126569 CACACTGGCAGCCCGTGTGG>C

Associated Papers

Nationwide genetic analysis of more than 600 families with inherited eye diseases in Argentina.

Schlottmann PG et al.

Npj Genomic Medicine, 2023

37217489 (PubMed )

Supplement: 41525_2023_352_MOESM2_ESM.xlsx › Hoja1

Select a paper to view details

UCSC Genome Browser·Imprint·Privacy·Terms·Feedback·Email Updates·

Regarding the variants extracted from papers and shown text snippets from research papers, the following holds: "Some rights reserved. This work permits non-commercial use, distribution and reproduction in any medium, provided the original author and source are credited."