Home Downloads UCSC Genome Browser Track Email Updates

Varaico: Literature-Extracted Genetic Variants

Include likely false extractions

Gene:PTEN

Variant:p.Y336_K342delFs

Back to variants list

PTEN

NM_000314.8:p.Y336_K342delFs

hg38:chr10:87961096 GATACTTTTCTCCAAATTTT>G

Associated Papers

Longitudinal dynamics of circulating tumor DNA for treatment monitoring in patients with breast cancer recurrence.

Yoo TR et al.

Scientific Reports, 2024

39215119 (PubMed )

Supplement: 41598_2024_70887_MOESM1_ESM.pdf

Select a paper to view details

UCSC Genome Browser·Imprint·Privacy·Terms·Feedback·Email Updates·

Regarding the variants extracted from papers and shown text snippets from research papers, the following holds: "Some rights reserved. This work permits non-commercial use, distribution and reproduction in any medium, provided the original author and source are credited."