Home Downloads UCSC Genome Browser Track Email Updates

Varaico: Literature-Extracted Genetic Variants

Include likely false extractions

Gene:WNT10A

Variant:p.P199_L205delFs

Back to variants list

WNT10A

NM_025216.3:p.P199_L205delFs

hg38:chr2:218890201 GCCCACAGCCAGCCCAGGCC>G

Associated Papers

Ectodermal dysplasias and isolated ectodermal anomalies: expanding the clinical and molecular spectrum in a cohort of 36 patients.

Doğan Arı AB et al.

European Journal of Pediatrics, 2025

41062838 (PubMed )

Select a paper to view details

UCSC Genome Browser·Imprint·Privacy·Terms·Feedback·Email Updates·

Regarding the variants extracted from papers and shown text snippets from research papers, the following holds: "Some rights reserved. This work permits non-commercial use, distribution and reproduction in any medium, provided the original author and source are credited."